Review



enzyme sphihf  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96

    Structured Review

    New England Biolabs enzyme sphihf
    Enzyme Sphihf, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 183 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sphi+enzymes/SphI-HF/pm42097145-754-21-23
    Average 96 stars, based on 183 article reviews
    enzyme sphihf - by Bioz Stars, 2026-09
    96/100 stars

    Images

    Related Articles

    Amplification:

    Article Title: Production of xylitol from glucose by a recombinant strain
    Article Snippet: The PCR was accomplished with an initial denaturation step of 30 sec at 98° C. followed by 30 cycles with 10 sec at 98° C./10 sec at 57° C./20 sec at 72° C., and a final extension step of 5 minutes at 72° C. The PCR product was separated on a 1% agarose gel, extracted and purified using the ZymocleanTM Gel DNA Recovery Kit (Zymo Research Corporation, Irvine, Calif.). .. The amplified LEU2 open reading frame was subsequently restriction digested with AscI and SphI enzymes (New England Biolabs, Ipswich, Mass.). .. Additionally, a blunting of the SphI site with the Blunting Enzyme Mix kit (New England Biolabs, Ipswich, Mass.) for 15 min at room temperature, followed by heat inactivation of the enzymes for 10 min at 70° C. was performed in between the SphI and AscI digestion.

    Article Title: Variable fitness effects of bacteriophage resistance mutations in Escherichia coli: implications for phage therapy.
    Article Snippet: .. To complement K15 capsule-related phage-resistant clones (ECP_3022, L17; ECP_3031, T10), the corresponding open reading frames (ORFs) were amplified from the WT strain 536 and cloned into the pUC18 plasmid (ampicillin 100 μg/mL) using BamHI and SphI enzymes (New England Biolabs, USA) (ECP_3022: F-GGATCCGAATGAGTTTGTGATGAAATT A, R-GCATGCTTACAAAGACAGAATCACTTTT; ECP_3031: F-GCATGCTTAAATTTCTGAGTACGGCAAA, R-GGATCCAATGGTGAAATATGAAAATCAA). ..

    Article Title: Variable fitness effects of bacteriophage resistance mutations in Escherichia coli: implications for phage therapy
    Article Snippet: .. To complement K15 capsule-related phage-resistant clones ( ECP_3022 , L17; ECP_3031 , T10), the corresponding open reading frames (ORFs) were amplified from the WT strain 536 and cloned into the pUC18 plasmid (ampicillin 100 μg/mL) using BamHI and SphI enzymes (New England Biolabs, USA) (ECP_3022: F- GGATCCGAATGAGTTTGTGATGAAATTA , R- GCATGCTTACAAAGACAGAATCACTTTT ; ECP_3031: F- GCATGCTTAAATTTCTGAGTACGGCAAA , R- GGATCCAATGGTGAAATATGAAAATCAA ). ..

    Ligation:

    Article Title: Dispersal ability predicts spatial genetic structure in native mammals persisting across an urbanization gradient
    Article Snippet: .. In brief, DNA was restriction‐digested with the MluCI and SphI enzymes (New England Biolabs), followed by ligation of a P1 adapter that contained one of 48 unique five‐nucleotide barcodes, and a P2 adapter ligated to fragment overhangs. ..

    Clone Assay:

    Article Title: Variable fitness effects of bacteriophage resistance mutations in Escherichia coli: implications for phage therapy.
    Article Snippet: .. To complement K15 capsule-related phage-resistant clones (ECP_3022, L17; ECP_3031, T10), the corresponding open reading frames (ORFs) were amplified from the WT strain 536 and cloned into the pUC18 plasmid (ampicillin 100 μg/mL) using BamHI and SphI enzymes (New England Biolabs, USA) (ECP_3022: F-GGATCCGAATGAGTTTGTGATGAAATT A, R-GCATGCTTACAAAGACAGAATCACTTTT; ECP_3031: F-GCATGCTTAAATTTCTGAGTACGGCAAA, R-GGATCCAATGGTGAAATATGAAAATCAA). ..

    Article Title: Variable fitness effects of bacteriophage resistance mutations in Escherichia coli: implications for phage therapy
    Article Snippet: .. To complement K15 capsule-related phage-resistant clones ( ECP_3022 , L17; ECP_3031 , T10), the corresponding open reading frames (ORFs) were amplified from the WT strain 536 and cloned into the pUC18 plasmid (ampicillin 100 μg/mL) using BamHI and SphI enzymes (New England Biolabs, USA) (ECP_3022: F- GGATCCGAATGAGTTTGTGATGAAATTA , R- GCATGCTTACAAAGACAGAATCACTTTT ; ECP_3031: F- GCATGCTTAAATTTCTGAGTACGGCAAA , R- GGATCCAATGGTGAAATATGAAAATCAA ). ..

    Plasmid Preparation:

    Article Title: Variable fitness effects of bacteriophage resistance mutations in Escherichia coli: implications for phage therapy.
    Article Snippet: .. To complement K15 capsule-related phage-resistant clones (ECP_3022, L17; ECP_3031, T10), the corresponding open reading frames (ORFs) were amplified from the WT strain 536 and cloned into the pUC18 plasmid (ampicillin 100 μg/mL) using BamHI and SphI enzymes (New England Biolabs, USA) (ECP_3022: F-GGATCCGAATGAGTTTGTGATGAAATT A, R-GCATGCTTACAAAGACAGAATCACTTTT; ECP_3031: F-GCATGCTTAAATTTCTGAGTACGGCAAA, R-GGATCCAATGGTGAAATATGAAAATCAA). ..

    Article Title: Variable fitness effects of bacteriophage resistance mutations in Escherichia coli: implications for phage therapy
    Article Snippet: .. To complement K15 capsule-related phage-resistant clones ( ECP_3022 , L17; ECP_3031 , T10), the corresponding open reading frames (ORFs) were amplified from the WT strain 536 and cloned into the pUC18 plasmid (ampicillin 100 μg/mL) using BamHI and SphI enzymes (New England Biolabs, USA) (ECP_3022: F- GGATCCGAATGAGTTTGTGATGAAATTA , R- GCATGCTTACAAAGACAGAATCACTTTT ; ECP_3031: F- GCATGCTTAAATTTCTGAGTACGGCAAA , R- GGATCCAATGGTGAAATATGAAAATCAA ). ..

    Article Title: Production of xylitol from glucose by a recombinant strain
    Article Snippet: The amplification was accomplished with an initial denaturation step of 30 sec at 98° C. followed by 30 cycles with 10 sec at 98° C./10 sec at 61° C./15 sec at 72° C., and a final extension step of 5 minutes at 72° C. The PCR product was separated on a 1% agarose gel, extracted and purified using the ZymocleanTM Gel DNA Recovery Kit (Zymo Research Corporation, Irvine, Calif.). .. The 567 bp fragment was restriction digested with PstI and SphI enzymes (New England Biolabs, Ipswich, Mass.) and ligated for 2 h at room temperature to the 3.9 kb vector backbone of pEVE2852 (FIG. 27) linearized with PstI and SphI restriction enzymes (New England Biolabs, Ipswich, Mass.) and gel-purified with ZymocleanTM Gel DNA Recovery Kit (Zymo Research Corporation, Irvine, Calif.) using T4 DNA ligase (New England Biolabs, Ipswich, Mass.) (FIG. 29). .. After transformation of XL10 Gold ultracompetent cells (Agilent Technologies, Santa Clara, Calif.) with the ligation mixture, plasmid DNA was isolated using the ZyppyTM Plasmid Miniprep Kit (Zymo Research Corporation, Irvine, Calif.) and further characterized by restriction digestion and sequencing (Microsynth, Balgach, Switzerland).

    Article Title: Mfd protects against oxidative stress in Bacillus subtilis independently of its canonical function in DNA repair.
    Article Snippet: The PCR products were then resolved on 1% Agarose gel and fragments corresponding to 1.2 kb size were excised out of the gel and cleaned up using the Qiagen MinElute Gel Extraction Kit (Venlo, Netherlands). .. The cleanup product was then digested using SalI and SphI enzymes (New England Biolabs, Ipswich, MA), ligated to the Phyperspank plasmid, and transformed into B. subtilis as described previously [57]. ..

    Transformation Assay:

    Article Title: Mfd protects against oxidative stress in Bacillus subtilis independently of its canonical function in DNA repair.
    Article Snippet: The PCR products were then resolved on 1% Agarose gel and fragments corresponding to 1.2 kb size were excised out of the gel and cleaned up using the Qiagen MinElute Gel Extraction Kit (Venlo, Netherlands). .. The cleanup product was then digested using SalI and SphI enzymes (New England Biolabs, Ipswich, MA), ligated to the Phyperspank plasmid, and transformed into B. subtilis as described previously [57]. ..

    Subcloning:

    Article Title: Production of xylitol from glucose by a recombinant strain
    Article Snippet: The synthesized DNA fragment encoding the NADPH-specific xylitol dehydrogenase from Gluconobacter oxydans was delivered as 5 μg lyophilized plasmid DNA in a pMA-T derived vector (13AAYSYP, FIG. 3). .. For further subcloning, the gene was released by restriction cutting with AscI and SphI enzymes (New England Biolabs, Ipswich, Mass.). .. The Cloning of a Vector with Replaceable: promoter, open reading frame, and terminator elements was performed by two successive overlap PCRs of three individual fragments (FIG. 4).



    Similar Products

    96
    New England Biolabs enzyme sphihf
    Enzyme Sphihf, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sphi+enzymes/SphI-HF/pm42097145-754-21-23
    Average 96 stars, based on 1 article reviews
    enzyme sphihf - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    New England Biolabs sphi restriction enzymes
    Sphi Restriction Enzymes, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sphi+enzymes/SphI/bio_rxiv__64898__2026__03__14__711032-246-15-18
    Average 96 stars, based on 1 article reviews
    sphi restriction enzymes - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    New England Biolabs restriction enzymes sphi hf
    Restriction Enzymes Sphi Hf, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sphi+enzymes/SphI-HF/pmc12943343-85-5-11
    Average 96 stars, based on 1 article reviews
    restriction enzymes sphi hf - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    New England Biolabs sphi restriction enzyme
    Sphi Restriction Enzyme, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sphi+enzymes/SphI/pm41315363-445-32-35
    Average 96 stars, based on 1 article reviews
    sphi restriction enzyme - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    New England Biolabs sph i restriction enzyme
    Sph I Restriction Enzyme, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sphi+enzymes/SphI/pmc12663350-444-32-36
    Average 96 stars, based on 1 article reviews
    sph i restriction enzyme - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    Image Search Results